Skip to main content

Table 1 Primers and probes used for RT-qPCR. Sequences are given as 5′-3′. Probes are tagged with 6-FAM at the 5′-end and BHQ1 at the 3′-end

From: Expression of human CD46 and trans-complementation by murine adenovirus 1 fails to allow productive infection by a group B oncolytic adenovirus in murine cancer cells

Gene Forward primer Reverse primer Probe
E1A CCATCTCCTGATTCTACTACC CCGTGTACTCAAGTCCAA TAAGCCTGGGAAACGTCCAGCAGT
E2B CTCTTCAATGATGTTACTTTCG GTAGCGAAGCGTGAGTAAG AGGCTCCCTGTTCCCAGAGTTGGA
Fibre ACCGAAGAGCAATAAATG TCGTCTTCTCTGATGTAG TCGTATAACTTGGTCCTGGAACACA