Fig. 2

T-cell recognition of BRAF N581I mutation in lung cancer patient LUAD-3001 responding to anti-PD-1 treatment. Individual 10-day peptide-stimulated cultures identified persistent mutation associated neoantigen-specific clonotypes (described in methods) detectable in the blood of patient LUAD-3001 > 2 years after complete tumor regression following PD-1 blockade. a Three clonotypes recognized the A*02:01-restricted BRAF N581I-derived IIFLHEDLTV peptide neoantigen (LUAD 26, left panel). The TGCAGTGTGAGAGCAGACAGGGGGGAAAATTCACCCCTCCACTTT clonotype was detected in the original resected tumor (center panel), whereas all three clonotypes were detected in serial peripheral blood samples obtained before and after PD-1 blockade (right panel). Data are shown as the number of cells detected after the 10 day culture (abundance) for cultured cells and the relative frequency (%) of each clonotype among all cells detected by TCRseq for FFPE tumor tissue and serial peripheral blood samples. b Duplicate binding assays were performed on the putative neoantigen and wild type counterpart, as well as the known MART1 mutant HLA A*02:01-restricted ELAGIGILTV epitope. Data are shown as mean counts per second, with error bars representing the standard deviation. c The lollipop plot shows the position of the patient’s BRAF N581I mutation among the other oncogenic mutations within the BRAF gene; green: missense mutations, black: truncating mutations, brown: inframe mutations, purple: other