Skip to main content

Table 1 antigen nucleotide and peptide sequence and MHC specificity (reactive T cell subtype [12])

From: Oncolytic adenovirus drives specific immune response generated by a poly-epitope pDNA vaccine encoding melanoma neoantigens into the tumor site

Antigen name Reactive T cell subtype [12] Nucleotide sequence in B16F1 cells Peptide sequence
TRP2 CD8 AGCGTGTACGACTTCTTCGTGTGGCTG SVYDFFVWL
Pbk CD8 GACAGCGGCAGCCCTTTTCCTGCTGCCGTGATCCTGAGAGATGCCCTGCACATGGCTAGAGGCCTGAAGTACCTGCACCAA DSGSPFPAAVILRDALHMARGLKYLHQ
Kif18b CD4 CCTAGCAAGCCCAGCTTCCAAGAGTTCGTGGACTGGGAGAACGTGTCCCCTGAGCTGAACTCTACCGACCAGCCTTTCCTG PSKPSFQEFVDWENVSPELNSTDQPFL
Cpsf3l CD4 GAGTTCAAGCACATCAAGGCCTTCGACAGAACCTTCGCTGACAACCCCGGACCTATGGTTCGACCTTGGCAGTCTGCTAGC EFKHIKAFDRTFADNPGPMVRPWQSAS
Sequence in B16F10 cells [12]: EFKHIKAFDRTFANNPGPMVVFATPGM
Gp100 CD4 TGGAACAGACAGCTGTACCCCGAGTGGACCGAGGCCCAGAGACTGGAT WNRQLYPEWTEAQRL
  1. List of the antigens used in the study. Mutated amino acids of the peptide sequence compared to the wild type sequence are in bold and underlined in the table. Mutated amino acids of the gene Cpsf3l in the B16F10 cells compared to the wild type sequence are in bold and not underlined (the sequence in the table is the sequence found in B16F10 cells by Kreiter et al. [12])