Skip to main content

Table 2 List of the primers used in this study

From: Oncolytic adenovirus drives specific immune response generated by a poly-epitope pDNA vaccine encoding melanoma neoantigens into the tumor site

Primer name   Primer sequence (5′ ➔ 3′) Amplicon length (bp)
Granzyme B For GAAGCCAGGAGATGTGTGCT 183
Rev GCACGTTTGGTCTTTGGGTC
Perforin For TCACACTGCCAGCGTAATGT 419
Rev AGGGCTGTAAGGACCGAGAT
TNFa For CATCTTCTCAAAATTCGAGTGACAA 175
Rev TGGGAGTAGACAAGGTACAACCC
IL2 For TCACATTGACACTTGTGCTCCT 191
Rev CATCCTGGGGAGTTTCAGGTTC
IL15 For TTGGGCTGTGTCAGTGTAGG 182
Rev TGCAATTCCAGGAGAAAGCAGT
IL12 For GGAAGCACGGCAGCAGAATA 180
Rev AACTTGAGGGAGAAGTAGGAATGG
IL1b For AACTGTTCCTGAACTCAACTGT 150
Rev GAGATTTGAAGCTGGATGCTCT
IL10 For GGTTGCCAAGCCTTATCGGA 115
Rev TCAGCTTCTCACCCAGGGAA
CCL5 For CTGCTGCTTTGCCTACCTCTC 149
Rev GAACCCACTTCTTCTCTGGGT
b-actin For ACTCCTATGTGGGTGACGAG 206
Rev CATCTTTTCACGGTTGGCCTTAG